US20230084118A1
MICROORGANISMS AND METHODS FOR THE BIOLOGICAL PRODUCTION OF ETHYLENE GLYCOL
Publication
Application
Classifications
IPC Classifications
CPC Classifications
Applicants
LanzaTech, Inc.
Inventors
Michael Koepke, Rasmus Jensen
Abstract
The invention provides genetically engineered microorganisms and methods for the biological production of ethylene glycol and precursors of ethylene glycol. In particular, the microorganism of the invention produces ethylene glycol or a precursor of ethylene glycol through one or more of 5,10-methylenetetrahydrofolate, oxaloacetate, citrate, malate, and glycine. The invention further provides compositions comprising ethylene glycol or polymers of ethylene glycol such as polyethylene terephthalate.
Figures
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001]This application is a continuation of U.S. patent application Ser. No. 16/226,603, filed on Dec. 19, 2018, which claims the benefit of U.S. Provisional Patent Application Nos. 62/607,446, filed on Dec. 19, 2017, and 62/683,454, filed on Jun. 11, 2018, the entirety of which are incorporated herein by reference.
REFERENCE TO A SEQUENCE LISTING
[0002]The application contains a Sequence Listing which has been submitted electronically in ST.26 Sequence listing XML format and is hereby incorporated by reference in its entirety. Said ST.26 Sequence listing XML, created on Nov. 23, 2022, is named LT133US2-Sequences_Corrected.xml and is 158,237 bytes in size.
BACKGROUND OF THE INVENTION
Field of the Invention
[0003]The present invention relates to genetically engineered microorganisms and methods for the production of ethylene glycol and ethylene glycol precursors by microbial fermentation, particularly by microbial fermentation of a gaseous substrate.
Description of Related Art
[0004]Ethylene glycol, also known as monoethylene glycol (MEG), has a current market value of over $33 billion USD and is an important component of a huge variety of industrial, medical, and consumer products. Ethylene glycol is currently produced using chemical catalysis processes that require large amounts of energy and water, generate a number of undesirable by-products, and rely on petrochemical feedstocks. Demand for sustainable materials has led to some technological advancements, such as the catalytic production of ethylene glycol from sugar-cane derived ethanol.
[0005]Ethylene glycol precursors are also commercially valuable. For example, glycolate is used in skin care, personal care, dyeing, tanning, and as a cleaning agent. Glyoxylate is an intermediate for vanillin, agricultural chemicals, antibiotics, allantoin, and complexing agents.
[0006]However, no microorganisms are known to be capable of biologically producing ethylene glycol, and no fully biological route to the production of ethylene glycol has been well-established. Some biological routes to ethylene glycol have been described in the literature from sugars. For example, Alkim et al., Microb Cell Fact, 14: 127, 2015 demonstrated ethylene glycol production from (D)-xylose in E. coli but noted that aerobic conditions were required to achieve high yields. Similarly, Pereira et al., Metab Eng, 34: 80-87, 2016 achieved ethylene glycol production from pentoses in E. coli. A few studies on ethylene glycol production from pentoses have also been conducted in S. cerevisiae but have shown inconsistent results. See, e.g., Uranukul et al., Metab Eng, 51: 20-31, 2018.
[0007]Gas fermentation offers a route to use a wide range of readily available, low cost C1 feedstocks such as industrial waste gases, syngas, or reformed methane into chemicals and fuels. Since gas fermentation metabolism is significantly different from sugar-fermenting metabolism, use of the above-mentioned routes is not practical, as these routes would require production of sugar precursors from gas via gluconeogenesis, an energy negative process. To date, no route to produce ethylene glycol from gaseous substrates is available.
[0008]In an explorative exercise, Islam et al., Metab Eng, 41: 173-181, 2017 predicted hundreds of hypothetical pathways for producing ethylene glycol from syngas in M. thermoacetia using cheminformatics tools. However, it is not possible even for a skilled person in the art to incorporate these pathways in a gas fermenting organism, as many of the pathways are infeasible either due to thermodynamic or other constraints. For example, nearly 2,000 oxygen or oxygen radical-dependent reactions were included in Islam et al., which would not be feasible in a strictly anaerobic system. The only identified hypothetical pathways by Islam et al. that have known reactions require gluconeogenesis or ethanol as an intermediate. Therefore, there remains a need for validated, energetically favorable recombinant production systems that can produce high yields of ethylene glycol and ethylene glycol precursors from gaseous substrates.
SUMMARY OF THE INVENTION
[0009]It is against the above background that the present invention provides certain advantages and advancements over the prior art.
[0010]Although this invention disclosed herein is not limited to specific advantages or functionalities, the invention provides a genetically engineered microorganism capable of producing ethylene glycol or a precursor of ethylene glycol from a gaseous substrate.
[0011]In some aspects of the microorganism disclosed herein, the microorganism produces ethylene glycol or the precursor of ethylene glycol through one or more intermediates selected from the group consisting of 5,10-methylenetetrahydrofolate, oxaloacetate, citrate, malate, and glycine.
[0012]In some aspects of the microorganism disclosed herein, the microorganism comprises one or more of a heterologous enzyme capable of converting oxaloacetate to citrate, a heterologous enzyme capable of converting glycine to glyoxylate, a heterologous enzyme capable of converting iso-citrate to glyoxylate, and a heterologous enzyme capable of converting glycolate to glycolaldehyde.
[0013]In some aspects of the microorganism disclosed herein, the heterologous enzyme capable of converting oxaloacetate to citrate is a citrate [Si]-synthase [2.3.3.1], an ATP citrate synthase [2.3.3.8]; or a citrate (Re)-synthase [2.3.3.3]; the heterologous enzyme capable of converting glycine to glyoxylate is an alanine-glyoxylate transaminase [2.6.1.44], a serine-glyoxylate transaminase [2.6.1.45], a serine-pyruvate transaminase [2.6.1.51], a glycine-oxaloacetate transaminase [2.6.1.35], a glycine transaminase [2.6.1.4], a glycine dehydrogenase [1.4.1.10], an alanine dehydrogenase [1.4.1.1], or a glycine dehydrogenase [1.4.2.1]; the heterologous enzyme capable of converting iso-citrate to glyoxylate is an isocitrate lyase [4.1.3.1]; and/or the heterologous enzyme capable of converting glycolate to glycolaldehyde is a glycolaldehyde dehydrogenase [1.2.1.21], a lactaldehyde dehydrogenase [1.2.1.22], a succinate-semialdehyde dehydrogenase [1.2.1.24], a 2,5-dioxovalerate dehydrogenase [1.2.1.26], an aldehyde dehydrogenase [1.2.1.3/4/5], a betaine-aldehyde dehydrogenase [1.2.1.8], or an aldehyde ferredoxin oxidoreductase [1.2.7.5].
[0014]In some aspects of the microorganism disclosed herein, the heterologous enzymes are derived from a genus selected from the group consisting of Bacillus, Clostridium, Escherichia, Gluconobacter, Hyphomicrobium, Lysinibacillus, Paenibacillus, Pseudomonas, Sedimenticola, Sporosarcina, Streptomyces, Thermithiobacillus, Thermotoga, and Zea.
[0015]In some aspects of the microorganism disclosed herein, one or more of the heterologous enzymes are codon-optimized for expression in the microorganism.
[0016]In some aspects of the microorganism disclosed herein, the microorganism further comprises one or more of an enzymes capable of converting acetyl-CoA to pyruvate; an enzyme capable of converting pyruvate to oxaloacetate; an enzyme capable of converting pyruvate to malate; an enzyme capable of converting pyruvate to phosphoenolpyruvate; an enzyme capable of converting oxaloacetate to citryl-CoA; an enzyme capable of converting citryl-CoA to citrate; an enzyme capable of converting citrate to aconitate and aconitate to iso-citrate; an enzyme capable of converting phosphoenolpyruvate to oxaloacetate; an enzyme capable of converting phosphoenolpyruvate to 2-phospho-D-glycerate; an enzyme capable of converting 2-phospho-D-glycerate to 3-phospho-D-glycerate; an enzyme capable of converting 3-phospho-D-glycerate to 3-phosphonooxypyruvate; an enzyme capable of converting 3-phosphonooxypyruvate to 3-phospho-L-serine; an enzyme capable of converting 3-phospho-L-serine to serine; an enzyme capable of converting serine to glycine; an enzyme capable of converting 5,10-methylenetetrahydrofolate to glycine; an enzyme capable of converting serine to hydroxypyruvate; an enzyme capable of converting D-glycerate to hydroxypyruvate; an enzyme capable of converting malate to glyoxylate; an enzyme capable of converting glyoxylate to glycolate; an enzyme capable of converting hydroxypyruvate to glycolaldehyde; and/or an enzyme capable of converting glycolaldehyde to ethylene glycol.
[0017]In some aspects of the microorganism disclosed herein, the microorganism overexpresses the heterologous enzyme capable of converting oxaloacetate to citrate, the heterologous enzyme capable of converting glycine to glyoxylate, and/or the heterologous enzyme capable of converting glycolate to glycolaldehyde.
[0018]In some aspects of the microorganism disclosed herein, the microorganism overexpresses the enzyme capable of converting pyruvate to oxaloacetate, the enzyme capable of converting citrate to aconitate and aconitate to iso-citrate, the enzyme capable of converting phosphoenolpyruvate to oxaloacetate, the enzyme capable of converting serine to glycine, the enzyme capable of converting 5,10-methylenetetrahydrofolate to glycine, the enzyme capable of converting glyoxylate to glycolate; and/or the enzyme capable of converting glycolaldehyde to ethylene glycol.
[0019]In some aspects of the microorganism disclosed herein, the microorganism comprises a disruptive mutation in one or more enzymes selected from the group consisting of isocitrate dehydrogenase, glycerate dehydrogenase, glycolate dehydrogenase, glycerate dehydrogenase, glycolate dehydrogenase, aldehyde ferredoxin oxidoreductase, and aldehyde dehydrogenase
[0020]In some aspects of the microorganism disclosed herein, the microorganism is a member of a genus selected from the group consisting of Acetobacterium, Alkalibaculum, Blautia, Butyribacterium, Clostridium, Eubacterium, Moorella, Oxobacter, Sporomusa, and Thermoanaerobacter.
[0021]In some aspects of the microorganism disclosed herein, the microorganism is derived from a parental microorganism selected from the group consisting of Acetobacterium woodii, Alkalibaculum bacchii, Blautia producta, Butyribacterium methylotrophicum, Clostridium aceticum, Clostridium autoethanogenum, Clostridium carboxidivorans, Clostridium coskatii, Clostridium drakei, Clostridium formicoaceticum, Clostridium ljungdahlii, Clostridium magnum, Clostridium ragsdalei, Clostridium scatologenes, Eubacterium limosum, Moorella thermautotrophica, Moorella thermoacetica, Oxobacter pfennigii, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, and Thermoanaerobacter kiuvi.
[0022]In some aspects of the microorganism disclosed herein, the microorganism is derived from a parental bacterium selected from the group consisting of Clostridium autoethanogenum, Clostridium ljungdahlii, and Clostridium ragsdalei.
[0023]In some aspects of the microorganism disclosed herein, the microorganism comprises a native or heterologous Wood-Ljungdahl pathway.
[0024]In some aspects of the microorganism disclosed herein, the microorganism produces glyoxylate or glycolate as a precursor of ethylene glycol.
[0025]The invention further provides a method of producing ethylene glycol or a precursor of ethylene glycol comprising culturing the microorganism disclosed herein in a nutrient medium and in the presence of a substrate, whereby the microorganism produces ethylene glycol or the precursor of ethylene glycol.
[0026]In some aspects of the method disclosed herein, the substrate comprises one or more of CO, CO2, and H2.
[0027]In some aspects of the method disclosed herein, at least a portion of the substrate is industrial waste gas, industrial off gas, or syngas.
[0028]In some aspects of the method disclosed herein, the microorganism produces glyoxylate or glycolate as precursors of ethylene glycol.
[0029]In some aspects of the method disclosed herein, the method further comprises separating the ethylene glycol or the ethylene glycol precursor from the nutrient medium.
[0030]In some aspects of the method disclosed herein, the microorganism further produces one or more of ethanol, 2,3-butanediol, and succinate.
[0031]The invention further provides a composition comprising ethylene glycol produced by the method described herein. In some aspects, the composition is an antifreeze, a preservative, a dehydrating agent, or a drilling fluid.
[0032]The invention further provides a polymer comprising ethylene glycol produced by the method described herein. In some aspects, the polymer is a homopolymer or a copolymer. In some aspects, the polymer is polyethylene glycol or polyethylene terephthalate.
[0033]The invention further provides a composition comprising the polymer described herein. In some aspects, the composition is a fiber, a resin, a film, or a plastic.
[0034]These and other features and advantages of the present invention will be more fully understood from the following detailed description taken together with the accompanying claims. It is noted that the scope of the claims is defined by the recitations therein and not by the specific discussion of features and advantages set forth in the present description.
DESCRIPTION OF THE DRAWINGS
[0035]The following detailed description of the embodiments of the present invention can be best understood when read in conjunction with the following drawings, where like structure is indicated with like reference numerals and in which:
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION OF THE INVENTION
[0042]The invention provides microorganisms for the biological production of ethylene glycol. A “microorganism” is a microscopic organism, especially a bacterium, archaeon, virus, or fungus. In a preferred embodiment, the microorganism of the invention is a bacterium.
[0043]The term “non-naturally occurring” when used in reference to a microorganism is intended to mean that the microorganism has at least one genetic modification not found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Non-naturally occurring microorganisms are typically developed in a laboratory or research facility. The microorganisms of the invention are non-naturally occurring.
[0044]The terms “genetic modification,” “genetic alteration,” or “genetic engineering” broadly refer to manipulation of the genome or nucleic acids of a microorganism by the hand of man. Likewise, the terms “genetically modified,” “genetically altered,” or “genetically engineered” refers to a microorganism containing such a genetic modification, genetic alteration, or genetic engineering. These terms may be used to differentiate a lab-generated microorganism from a naturally-occurring microorganism. Methods of genetic modification of include, for example, heterologous gene expression, gene or promoter insertion or deletion, nucleic acid mutation, altered gene expression or inactivation, enzyme engineering, directed evolution, knowledge-based design, random mutagenesis methods, gene shuffling, and codon optimization. The microorganisms of the invention are genetically engineered.
[0045]“Recombinant” indicates that a nucleic acid, protein, or microorganism is the product of genetic modification, engineering, or recombination. Generally, the term “recombinant” refers to a nucleic acid, protein, or microorganism that contains or is encoded by genetic material derived from multiple sources, such as two or more different strains or species of microorganisms. The microorganisms of the invention are generally recombinant.
[0046]“Wild type” refers to the typical form of an organism, strain, gene, or characteristic as it occurs in nature, as distinguished from mutant or variant forms.
[0047]“Endogenous” refers to a nucleic acid or protein that is present or expressed in the wild-type or parental microorganism from which the microorganism of the invention is derived. For example, an endogenous gene is a gene that is natively present in the wild-type or parental microorganism from which the microorganism of the invention is derived. In one embodiment, the expression of an endogenous gene may be controlled by an exogenous regulatory element, such as an exogenous promoter.
[0048]“Exogenous” refers to a nucleic acid or protein that originates outside the microorganism of the invention. For example, an exogenous gene or enzyme may be artificially or recombinantly created and introduced to or expressed in the microorganism of the invention. An exogenous gene or enzyme may also be isolated from a heterologous microorganism and introduced to or expressed in the microorganism of the invention. Exogenous nucleic acids may be adapted to integrate into the genome of the microorganism of the invention or to remain in an extra-chromosomal state in the microorganism of the invention, for example, in a plasmid.
[0049]“Heterologous” refers to a nucleic acid or protein that is not present in the wild-type or parental microorganism from which the microorganism of the invention is derived. For example, a heterologous gene or enzyme may be derived from a different strain or species and introduced to or expressed in the microorganism of the invention. The heterologous gene or enzyme may be introduced to or expressed in the microorganism of the invention in the form in which it occurs in the different strain or species. Alternatively, the heterologous gene or enzyme may be modified in some way, e.g., by codon-optimizing it for expression in the microorganism of the invention or by engineering it to alter function, such as to reverse the direction of enzyme activity or to alter substrate specificity.
[0050]In particular, a heterologous nucleic acid or protein expressed in the microorganism described herein may be derived from Bacillus, Clostridium, Escherichia, Gluconobacter, Hyphomicrobium, Lysinibacillus, Paenibacillus, Pseudomonas, Sedimenticola, Sporosarcina, Streptomyces, Thermithiobacillus, Thermotoga, Zea, Klebsiella, Mycobacterium, Salmonella, Mycobacteroides, Staphylococcus, Burkholderia, Listeria, Acinetobacter, Shigella, Neisseria, Bordetella, Streptococcus, Enterobacter, Vibrio, Legionella, Xanthomonas, Serratia, Cronobacter, Cupriavidus, Helicobacter, Yersinia, Cutibacterium, Francisella, Pectobacterium, Arcobacter, Lactobacillus, Shewanella, Erwinia, Sulfurospirillum, Peptococcaceae, Thermococcus, Saccharomyces, Pyrococcus, Glycine, Homo, Ralstonia, Brevibacterium, Methylobacterium, Geobacillus, bos, gallus, Anaerococcus, Xenopus, Amblyrhynchus, rattus, mus, sus, Rhodococcus, Rhizobium, Megasphaera, Mesorhizobium, Peptococcus, Agrobacterium, Campylobacter, Acetobacterium, Alkalibaculum, Blautia, Butyribacterium, Eubacterium, Moorella, Oxobacter, Sporomusa, Thermoanaerobacter, Schizosaccharomyces, Paenibacillus, Fictibacillus, Lysinibacillus, Ornithinibacillus, Halobacillus, Kurthia, Lentibacillus, Anoxybacillus, Solibacillus, Virgibacillus, Alicyclobacillus, Sporosarcina, Salimicrobium, Sporosarcina, Planococcus, Corynebacterium, Thermaerobacter, Sulfobacillus, or Symbiobacterium.
[0051]The terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
[0052]Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides or nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
[0053]As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene products.”
[0054]The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein, the term “amino acid” includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
[0055]“Enzyme activity,” or simply “activity,” refers broadly to enzymatic activity, including, but not limited, to the activity of an enzyme, the amount of an enzyme, or the availability of an enzyme to catalyze a reaction. Accordingly, “increasing” enzyme activity includes increasing the activity of an enzyme, increasing the amount of an enzyme, or increasing the availability of an enzyme to catalyze a reaction. Similarly, “decreasing” enzyme activity includes decreasing the activity of an enzyme, decreasing the amount of an enzyme, or decreasing the availability of an enzyme to catalyze a reaction.
[0056]“Mutated” refers to a nucleic acid or protein that has been modified in the microorganism of the invention compared to the wild-type or parental microorganism from which the microorganism of the invention is derived. In one embodiment, the mutation may be a deletion, insertion, or substitution in a gene encoding an enzyme. In another embodiment, the mutation may be a deletion, insertion, or substitution of one or more amino acids in an enzyme.
[0057]A “parental microorganism” is a microorganism used to generate a microorganism of the invention. The parental microorganism may be a naturally-occurring microorganism (i.e., a wild-type microorganism) or a microorganism that has been previously modified (i.e., a mutant or recombinant microorganism). The microorganism of the invention may be modified to express or overexpress one or more enzymes that were not expressed or overexpressed in the parental microorganism. Similarly, the microorganism of the invention may be modified to contain one or more genes that were not contained by the parental microorganism. The microorganism of the invention may also be modified to not express or to express lower amounts of one or more enzymes that were expressed in the parental microorganism.
[0058]The microorganism of the invention may be derived from essentially any parental microorganism. In one embodiment, the microorganism of the invention may be derived from a parental microorganism selected from the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, Escherichia coli, and Saccharomyces cerevisiae. In other embodiments, the microorganism is derived from a parental microorganism selected from the group consisting of Acetobacterium woodii, Alkalibaculum bacchii, Blautia product, Butyribacterium methylotrophicum, Clostridium aceticum, Clostridium autoethanogenum, Clostridium carboxidivorans, Clostridium coskatii, Clostridium drakei, Clostridium formicoaceticum, Clostridium ljungdahlii, Clostridium magnum, Clostridium ragsdalei, Clostridium scatologenes, Eubacterium limosum, Moorella thermautotrophica, Moorella thermoacetica, Oxobacter pfennigii, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, and Thermoanaerobacter kivui. In a preferred embodiment, the parental microorganism is Clostridium autoethanogenum, Clostridium ljungdahlii, or Clostridium ragsdalei. In an especially preferred embodiment, the parental microorganism is Clostridium autoethanogenum LZ1561, which was deposited on Jun. 7, 2010 with Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ) located at Inhoffenstraße 7B, D-38124 Braunschweig, Germany on Jun. 7, 2010 under the terms of the Budapest Treaty and accorded accession number DSM23693. This strain is described in International Patent Application No. PCT/NZ2011/000144, which published as WO 2012/015317.
[0059]The term “derived from” indicates that a nucleic acid, protein, or microorganism is modified or adapted from a different (e.g., a parental or wild-type) nucleic acid, protein, or microorganism, so as to produce a new nucleic acid, protein, or microorganism. Such modifications or adaptations typically include insertion, deletion, mutation, or substitution of nucleic acids or genes. Generally, the microorganism of the invention is derived from a parental microorganism. In one embodiment, the microorganism of the invention is derived from Clostridium autoethanogenum, Clostridium ljungdahlii, or Clostridium ragsdalei. In a preferred embodiment, the microorganism of the invention is derived from Clostridium autoethanogenum LZ1561, which is deposited under DSMZ accession number DSM23693.
[0060]The microorganism of the invention may be further classified based on functional characteristics. For example, the microorganism of the invention may be or may be derived from a C1-fixing microorganism, an anaerobe, an acetogen, an ethanologen, a carboxydotroph, and/or a methanotroph.
[0061]Table 1 provides a representative list of microorganisms and identifies their functional characteristics.
| TABLE 1 | ||||||||
|---|---|---|---|---|---|---|---|---|
| Wood-Ljungdahl | C1-fixing | Anaerobe | Acetogen | Ethanologen | Autotroph | Carboxydotroph | ||
| + | + | + | + | +/− 1 | + | − | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − | + | +/− 2 | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | + | + | + | |
| + | + | + | + | − 3 | + | + | |
| + | + | + | + | − | + | + | |
| + | + | + | + | − | + | +/− 4 | |
| + | + | + | + | − | + | +/− 5 | |
| + | + | + | + | − | + | +/− 6 | |
| + | + | + | + | − | + | − | |
[0062]“Wood-Ljungdahl ” refers to the Wood-Ljungdahl pathway of carbon fixation as described, e.g., by Ragsdale, Biochim Biophys Acta, 1784: 1873-1898, 2008. “Wood-Ljungdahl microorganisms” refers, predictably, to microorganisms containing the Wood-Ljungdahl pathway. Often, the microorganism of the invention contains a native Wood-Ljungdahl pathway. Herein, a Wood-Ljungdahl pathway may be a native, unmodified Wood-Ljungdahl pathway or it may be a Wood-Ljungdahl pathway with some degree of genetic modification (e.g., overexpression, heterologous expression, knockout, etc.) so long as it still functions to convert CO, CO2, and/or H2 to acetyl-CoA.
[0063]“C1” refers to a one-carbon molecule, for example, CO, CO2, CH4, or CH3OH. “C1-oxygenate” refers to a one-carbon molecule that also comprises at least one oxygen atom, for example, CO, CO2, or CH3OH. “C1-carbon source” refers a one carbon-molecule that serves as a partial or sole carbon source for the microorganism of the invention. For example, a C1-carbon source may comprise one or more of CO, CO2, CH4, CH3OH, or CH2O2. Preferably, the C1-carbon source comprises one or both of CO and CO2. A “C1-fixing microorganism” is a microorganism that has the ability to produce one or more products from a C1-carbon source. Often, the microorganism of the invention is a C1-fixing bacterium. In a preferred embodiment, the microorganism of the invention is derived from a C1-fixing microorganism identified in Table 1.
[0064]An “anaerobe” is a microorganism that does not require oxygen for growth. An anaerobe may react negatively or even die if oxygen is present above a certain threshold. However, some anaerobes are capable of tolerating low levels of oxygen (e.g., 0.000001-5% oxygen), sometimes referred to as “microoxic conditions.” Often, the microorganism of the invention is an anaerobe. In a preferred embodiment, the microorganism of the invention is derived from an anaerobe identified in Table 1.
[0065]“Acetogens” are obligately anaerobic bacteria that use the Wood-Ljungdahl pathway as their main mechanism for energy conservation and for synthesis of acetyl-CoA and acetyl-CoA-derived products, such as acetate (Ragsdale, Biochim Biophys Acta, 1784: 1873-1898, 2008). In particular, acetogens use the Wood-Ljungdahl pathway as a (1) mechanism for the reductive synthesis of acetyl-CoA from CO2, (2) terminal electron-accepting, energy conserving process, (3) mechanism for the fixation (assimilation) of CO2 in the synthesis of cell carbon (Drake, Acetogenic Prokaryotes, In: The Prokaryotes, 3rd edition, p. 354, New York, N.Y., 2006). All naturally occurring acetogens are C1-fixing, anaerobic, autotrophic, and non-methanotrophic. Often, the microorganism of the invention is an acetogen. In a preferred embodiment, the microorganism of the invention is derived from an acetogen identified in Table 1.
[0066]An “ethanologen” is a microorganism that produces or is capable of producing ethanol. Often, the microorganism of the invention is an ethanologen. In a preferred embodiment, the microorganism of the invention is derived from an ethanologen identified in Table 1.
[0067]An “autotroph” is a microorganism capable of growing in the absence of organic carbon. Instead, autotrophs use inorganic carbon sources, such as CO and/or CO2. Often, the microorganism of the invention is an autotroph. In a preferred embodiment, the microorganism of the invention is derived from an autotroph identified in Table 1.
[0068]A “carboxydotroph” is a microorganism capable of utilizing CO as a sole source of carbon and energy. Often, the microorganism of the invention is a carboxydotroph. In a preferred embodiment, the microorganism of the invention is derived from a carboxydotroph identified in Table 1.
[0069]A “methanotroph” is a microorganism capable of utilizing methane as a sole source of carbon and energy. In certain embodiments, the microorganism of the invention is a methanotroph or is derived from a methanotroph. In other embodiments, the microorganism of the invention is not a methanotroph or is not derived from a methanotroph.
[0070]In a preferred embodiment, the microorganism of the invention is derived from the cluster of Clostridia comprising the species Clostridium autoethanogenum, Clostridium ljungdahlii, and Clostridium ragsdalei. These species were first reported and characterized by Abrini, Arch Microbiol, 161: 345-351, 1994 (Clostridium autoethanogenum), Tanner, Int J System Bacteriol, 43: 232-236, 1993 (Clostridium ljungdahlii), and Huhnke, WO 2008/028055 (Clostridium ragsdalei).
[0071]These three species have many similarities. In particular, these species are all C1-fixing, anaerobic, acetogenic, ethanologenic, and carboxydotrophic members of the genus Clostridium. These species have similar genotypes and phenotypes and modes of energy conservation and fermentative metabolism. Moreover, these species are clustered in clostridial rRNA homology group I with 16S rRNA DNA that is more than 99% identical, have a DNA G+C content of about 22-30 mol %, are gram-positive, have similar morphology and size (logarithmic growing cells between 0.5-0.7×3-5 μm), are mesophilic (grow optimally at 30-37° C.), have similar pH ranges of about 4-7.5 (with an optimal pH of about 5.5-6), lack cytochromes, and conserve energy via an Rnf complex. Also, reduction of carboxylic acids into their corresponding alcohols has been shown in these species (Perez, Biotechnol Bioeng, 110:1066-1077, 2012). Importantly, these species also all show strong autotrophic growth on CO-containing gases, produce ethanol and acetate (or acetic acid) as main fermentation products, and produce small amounts of 2,3-butanediol and lactic acid under certain conditions.
[0072]However, these three species also have a number of differences. These species were isolated from different sources: Clostridium autoethanogenum from rabbit gut, Clostridium ljungdahlii from chicken yard waste, and Clostridium ragsdalei from freshwater sediment. These species differ in utilization of various sugars (e.g., rhamnose, arabinose), acids (e.g., gluconate, citrate), amino acids (e.g., arginine, histidine), and other substrates (e.g., betaine, butanol). Moreover, these species differ in auxotrophy to certain vitamins (e.g., thiamine, biotin). These species have differences in nucleic and amino acid sequences of Wood-Ljungdahl pathway genes and proteins, although the general organization and number of these genes and proteins has been found to be the same in all species (Köpke, Curr Opin Biotechnol, 22: 320-325, 2011).
[0073]Thus, in summary, many of the characteristics of Clostridium autoethanogenum, Clostridium ljungdahlii, or Clostridium ragsdalei are not specific to that species, but are rather general characteristics for this cluster of C1-fixing, anaerobic, acetogenic, ethanologenic, and carboxydotrophic members of the genus Clostridium. However, since these species are, in fact, distinct, the genetic modification or manipulation of one of these species may not have an identical effect in another of these species. For instance, differences in growth, performance, or product production may be observed.
[0074]The microorganism of the invention may also be derived from an isolate or mutant of Clostridium autoethanogenum, Clostridium ljungdahlii, or Clostridium ragsdalei. Isolates and mutants of Clostridium autoethanogenum include JA1-1 (DSM10061) (Abrini, Arch Microbiol, 161: 345-351, 1994), LBS1560 (DSM19630) (WO 2009/064200), and LZ1561 (DSM23693) (WO 2012/015317). Isolates and mutants of Clostridium ljungdahlii include ATCC 49587 (Tanner, Int J Syst Bacteriol, 43: 232-236, 1993), PETCT (DSM13528, ATCC 55383), ERI-2 (ATCC 55380) (U.S. Pat. No. 5,593,886), C-01 (ATCC 55988) (U.S. Pat. No. 6,368,819), O-52 (ATCC 55989) (U.S. Pat. No. 6,368,819), and OTA-1 (Tirado-Acevedo, Production of bioethanol from synthesis gas using Clostridium ljungdahlii, PhD thesis, North Carolina State University, 2010). Isolates and mutants of Clostridium ragsdalei include PI 1 (ATCC BAA-622, ATCC PTA-7826) (WO 2008/028055).
[0075]As described above, however, the microorganism of the invention may also be derived from essentially any parental microorganism, such as a parental microorganism selected from the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, Escherichia coli, and Saccharomyces cerevisiae.
[0076]The invention provides microorganisms capable of producing ethylene glycol, glyoxylate, and glycolate as well as methods of producing ethylene glycol, glyoxylate, and glycolate comprising culturing the microorganism of the invention in the presence of a substrate, whereby the microorganism produces ethylene glycol.
[0077]A microorganism of the invention may comprise an enzyme that converts acetyl-CoA, such as acetyl-CoA produced by the Wood-Ljungdahl pathway, to pyruvate (reaction 1 of
[0078]A microorganism of the invention may comprise an enzyme that converts pyruvate to oxaloacetate (reaction 2 of
[0079]A microorganism of the invention may comprise an enzyme that converts oxaloacetate to citryl-CoA (reaction 3 of
[0080]A microorganism of the invention may comprise an enzyme that converts citryl-CoA to citrate (reaction 4 of
[0081]A microorganism of the invention may comprise an enzyme that converts oxaloacetate to citrate (reaction 5 of
[0082]A microorganism of the invention may comprise an enzyme that converts citrate to aconitate and aconitate to iso-citrate (reactions 6 of
[0084]A microorganism of the invention may comprise an enzyme that converts glyoxylate to glycolate (reaction 8 of
[0085]A microorganism of the invention may comprise an enzyme that converts glycolate to glycolaldehyde (reaction 9 of
[0086]A microorganism of the invention may comprise an enzyme that converts glycolaldehyde to ethylene glycol (reaction 10 of
[0087]A microorganism of the invention may comprise an enzyme that converts pyruvate to malate (reaction 11 of
[0088]A microorganism of the invention may comprise an enzyme that converts malate to glyoxylate (reaction 12 of
[0089]A microorganism of the invention may comprise an enzyme that converts pyruvate to phosphoenolpyruvate (reaction 13 of
[0090]A microorganism of the invention may comprise an enzyme that converts phosphoenolpyruvate to 2-phospho-D-glycerate (reaction 14 of
[0091]A microorganism of the invention may comprise an enzyme that converts 2-phospho-D-glycerate to 3-phospho-D-glycerate (reaction 15 of
[0092]A microorganism of the invention may comprise an enzyme that converts 3-phospho-D-glycerate to 3-phosphonooxypyruvate (reaction 16 of
[0093]A microorganism of the invention may comprise an enzyme that converts 3-phosphonooxypyruvate to 3-phospho-L-serine (reaction 17 of
[0094]A microorganism of the invention may comprise an enzyme that converts 3-phospho-L-serine to serine (reaction 18 of
[0095]A microorganism of the invention may comprise an enzyme that converts serine to glycine (reaction 19 of
[0096]A microorganism of the invention may comprise an enzyme that converts glycine to glyoxylate (reaction 20 of
[0097]A microorganism of the invention may comprise an enzyme that converts serine to hydroxypyruvate (reaction 21 of
[0098]A microorganism of the invention may comprise an enzyme that converts hydroxypyruvate to glycolaldehyde (reaction 22 of
[0099]A microorganism of the invention may comprise an enzyme that converts D-glycerate to hydroxypyruvate (reaction 23 of
[0100]A microorganism of the invention may comprise a complex of enzymes that converts 5,10-methylenetetrahydrofolate to glycine (reaction 24 of
[0101]A microorganism of the invention may comprise an enzyme that converts phosphoenolpyruvate to oxaloacetate (reaction 25 of
[0102]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0103]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0104]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0105]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0106]In some embodiments, a microorganism comprising a complex of enzymes that converts 5,10-methylenetetrahydrofolate to glycine (reaction 24 of
[0107]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0108]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0109]In some embodiments, a microorganism comprising an enzyme that converts acetyl-CoA to pyruvate (reaction 1 of
[0110]In some embodiments, a microorganism comprising an enzyme that converts D-glycerate to hydroxypyruvate (reaction 23 of
[0111]The enzymes of the invention may be codon optimized for expression in the microorganism of the invention. “Codon optimization” refers to the mutation of a nucleic acid, such as a gene, for optimized or improved translation of the nucleic acid in a particular strain or species. Codon optimization may result in faster translation rates or higher translation accuracy. In a preferred embodiment, the genes of the invention are codon optimized for expression in the microorganism of the invention. Although codon optimization refers to the underlying genetic sequence, codon optimization often results in improved translation and, thus, improved enzyme expression. Accordingly, the enzymes of the invention may also be described as being codon optimized.
[0112]One or more of the enzymes of the invention may be overexpressed. “Overexpressed” refers to an increase in expression of a nucleic acid or protein in the microorganism of the invention compared to the wild-type or parental microorganism from which the microorganism of the invention is derived. Overexpression may be achieved by any means known in the art, including modifying gene copy number, gene transcription rate, gene translation rate, or enzyme degradation rate. As described above, one or more of the enzymes catalyzing reactions 2, 5, 6, 8, 9, 10, 19, 20, 24, or 25 of
[0113]The enzymes of the invention may comprise a disruptive mutation. A “disruptive mutation” refers to a mutation that reduces or eliminates (i.e., “disrupts”) the expression or activity of a gene or enzyme. The disruptive mutation may partially inactivate, fully inactivate, or delete the gene or enzyme. The disruptive mutation may be a knockout (KO) mutation. The disruptive mutation may be any mutation that reduces, prevents, or blocks the biosynthesis of a product produced by an enzyme. The disruptive mutation may include, for example, a mutation in a gene encoding an enzyme, a mutation in a genetic regulatory element involved in the expression of a gene encoding an enzyme, the introduction of a nucleic acid which produces a protein that reduces or inhibits the activity of an enzyme, or the introduction of a nucleic acid (e.g., antisense RNA, siRNA, CRISPR) or protein which inhibits the expression of an enzyme. The disruptive mutation may be introduced using any method known in the art.
[0114]In some embodiments, the microorganism of the invention comprises a disruptive mutation in isocitrate dehydrogenase [1.1.1.41]. Isocitrate dehydrogenase converts iso-citrate to 2-oxoglutarate. Disruption of isocitrate dehydrogenase, such as by deleting isocitrate dehydrogenase, results in increased levels of iso-citrate.
[0115]In some embodiments, the microorganism of the invention comprises a disruptive mutation in glycerate dehydrogenase [1.1.1.29]. Glycerate dehydrogenase converts glyoxylate to glycolate. Disruption of glycerate dehydrogenase, such as by deleting isocitrate dehydrogenase, results in increased levels of glyoxylate.
[0116]In some embodiments, the microorganism of the invention comprises a disruptive mutation in glycolate dehydrogenase [1.1.99.14]. Glycolate dehydrogenase converts glyoxylate to glycolate. Disruption of glycolate dehydrogenase, such as by deleting glycolate dehydrogenase, results in increased levels of glyoxylate.
[0117]In some embodiments, the microorganism of the invention comprises a disruptive mutation in aldehyde ferredoxin oxidoreductase [1.2.7.5]. Aldehyde ferredoxin oxidoreductase converts glycolate to glycolaldehyde. Disruption of aldehyde ferredoxin oxidoreductase, such as by deleting aldehyde ferredoxin oxidoreductase, results in increased levels of glycolate.
[0118]In some embodiments, the microorganism of the invention comprises a disruptive mutation in aldehyde dehydrogenase [1.2.1.3/1.2.3.4/1.2.3.5]. Aldehyde dehydrogenase converts glycolate to glycolaldehyde. Disruption of aldehyde dehydrogenase, such as by deleting aldehyde dehydrogenase, results in increased levels of glycolate.
[0119]Introduction of a disruptive mutation results in a microorganism of the invention that produces no target product or substantially no target product or a reduced amount of target product compared to the parental microorganism from which the microorganism of the invention is derived. For example, the microorganism of the invention may produce no target product or at least about 1%, 3%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% less target product than the parental microorganism. For example, the microorganism of the invention may produce less than about 0.001, 0.01, 0.10, 0.30, 0.50, or 1.0 g/L target product.
[0120]Although exemplary sequences and sources for enzymes are provided herein, the invention is by no means limited to these sequences and sources—it also encompasses variants. The term “variants” includes nucleic acids and proteins whose sequence varies from the sequence of a reference nucleic acid and protein, such as a sequence of a reference nucleic acid and protein disclosed in the prior art or exemplified herein. The invention may be practiced using variant nucleic acids or proteins that perform substantially the same function as the reference nucleic acid or protein. For example, a variant protein may perform substantially the same function or catalyze substantially the same reaction as a reference protein. A variant gene may encode the same or substantially the same protein as a reference gene. A variant promoter may have substantially the same ability to promote the expression of one or more genes as a reference promoter.
[0121]Such nucleic acids or proteins may be referred to herein as “functionally equivalent variants.” By way of example, functionally equivalent variants of a nucleic acid may include allelic variants, fragments of a gene, mutated genes, polymorphisms, and the like. Homologous genes from other microorganisms are also examples of functionally equivalent variants. These include homologous genes in species such as Clostridium acetobutylicum, Clostridium beijerinckii, or Clostridium ljungdahlii, the details of which are publicly available on websites such as Genbank or NCBI. Functionally equivalent variants also include nucleic acids whose sequence varies as a result of codon optimization for a particular microorganism. A functionally equivalent variant of a nucleic acid will preferably have at least approximately 70%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 98%, or greater nucleic acid sequence identity (percent homology) with the referenced nucleic acid. A functionally equivalent variant of a protein will preferably have at least approximately 70%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 98%, or greater amino acid identity (percent homology) with the referenced protein. The functional equivalence of a variant nucleic acid or protein may be evaluated using any method known in the art.
[0122]Nucleic acids may be delivered to a microorganism of the invention using any method known in the art. For example, nucleic acids may be delivered as naked nucleic acids or may be formulated with one or more agents, such as liposomes. The nucleic acids may be DNA, RNA, cDNA, or combinations thereof, as is appropriate. Restriction inhibitors may be used in certain embodiments. Additional vectors may include plasmids, viruses, bacteriophages, cosmids, and artificial chromosomes. In a preferred embodiment, nucleic acids are delivered to the microorganism of the invention using a plasmid. By way of example, transformation (including transduction or transfection) may be achieved by electroporation, ultrasonication, polyethylene glycol-mediated transformation, chemical or natural competence, protoplast transformation, prophage induction, or conjugation. In certain embodiments having active restriction enzyme systems, it may be necessary to methylate a nucleic acid before introduction of the nucleic acid into a microorganism.
[0123]Furthermore, nucleic acids may be designed to comprise a regulatory element, such as a promoter, to increase or otherwise control expression of a particular nucleic acid. The promoter may be a constitutive promoter or an inducible promoter. Ideally, the promoter is a Wood-Ljungdahl pathway promoter, a ferredoxin promoter, a pyruvate ferredoxin oxidoreductase promoter, an Rnf complex operon promoter, an ATP synthase operon promoter, or a phosphotransacetylase/acetate kinase operon promoter.
[0124]“Substrate” refers to a carbon and/or energy source for the microorganism of the invention. Often, the substrate is gaseous and comprises a C1-carbon source, for example, CO, CO2, and/or CH4. Preferably, the substrate comprises a C1-carbon source of CO or CO+CO2. The substrate may further comprise other non-carbon components, such as H2, N2, or electrons. In other embodiments, however, the substrate may be a carbohydrate, such as sugar, starch, fiber, lignin, cellulose, or hemicellulose or a combination thereof. For example, the carbohydrate may be fructose, galactose, glucose, lactose, maltose, sucrose, xylose, or some combination thereof. In some embodiments, the substrate does not comprise (D)-xylose (Alkim, Microb Cell Fact, 14: 127, 2015). In some embodiments, the substrate does not comprise a pentose such as xylose (Pereira, Metab Eng, 34: 80-87, 2016). In some embodiments, the substrate may comprise both gaseous and carbohydrate substrates (mixotrophic fermentation).
[0125]The gaseous substrate generally comprises at least some amount of CO, such as about 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mol % CO. The gaseous substrate may comprise a range of CO, such as about 20-80, 30-70, or 40-60 mol % CO. Preferably, the gaseous substrate comprises about 40-70 mol % CO (e.g., steel mill or blast furnace gas), about 20-30 mol % CO (e.g., basic oxygen furnace gas), or about 15-45 mol % CO (e.g., syngas). In some embodiments, the gaseous substrate may comprise a relatively low amount of CO, such as about 1-10 or 1-20 mol % CO. The microorganism of the invention typically converts at least a portion of the CO in the gaseous substrate to a product. In some embodiments, the gaseous substrate comprises no or substantially no (<1 mol %) CO.
[0126]The gaseous substrate may comprise some amount of H2. For example, the gaseous substrate may comprise about 1, 2, 5, 10, 15, 20, or 30 mol % H2. In some embodiments, the gaseous substrate may comprise a relatively high amount of H2, such as about 60, 70, 80, or 90 mol % H2. In further embodiments, the gaseous substrate comprises no or substantially no (<1 mol %) H2.
[0127]The gaseous substrate may comprise some amount of CO2. For example, the gaseous substrate may comprise about 1-80 or 1-30 mol % CO2. In some embodiments, the gaseous substrate may comprise less than about 20, 15, 10, or 5 mol % CO2. In another embodiment, the gaseous substrate comprises no or substantially no (<1 mol %) CO2.
[0128]The gaseous substrate may also be provided in alternative forms. For example, the gaseous substrate may be dissolved in a liquid or adsorbed onto a solid support.
[0129]The gaseous substrate and/or C1-carbon source may be a waste gas or an off gas obtained as a byproduct of an industrial process or from some other source, such as from automobile exhaust fumes or biomass gasification. In certain embodiments, the industrial process is selected from the group consisting of ferrous metal products manufacturing, such as a steel mill manufacturing, non-ferrous products manufacturing, petroleum refining, coal gasification, electric power production, carbon black production, ammonia production, methanol production, and coke manufacturing. In these embodiments, the gaseous substrate and/or C1-carbon source may be captured from the industrial process before it is emitted into the atmosphere, using any convenient method.
[0130]The gaseous substrate and/or C1-carbon source may be syngas, such as syngas obtained by gasification of coal or refinery residues, gasification of biomass or lignocellulosic material, or reforming of natural gas. In another embodiment, the syngas may be obtained from the gasification of municipal solid waste or industrial solid waste.
[0131]The composition of the gaseous substrate may have a significant impact on the efficiency and/or cost of the reaction. For example, the presence of oxygen (O2) may reduce the efficiency of an anaerobic fermentation process. Depending on the composition of the substrate, it may be desirable to treat, scrub, or filter the substrate to remove any undesired impurities, such as toxins, undesired components, or dust particles, and/or increase the concentration of desirable components.
[0132]In certain embodiments, the fermentation is performed in the absence of carbohydrate substrates, such as sugar, starch, fiber, lignin, cellulose, or hemicellulose.
[0133]In some embodiments, the overall energetics of CO and H2 to ethylene glycol (MEG) are preferable to those from glucose to ethylene glycol, as shown below, wherein the more negative Gibbs free energy, ΔrG′m, values for CO and H2 indicate a larger driving force towards ethylene glycol. Calculations of overall reaction delta G for the comparison of glucose vs CO as a substrate were performed using equilibrator (http://equilibrator.weizmann.ac.il/), which is a standard method for evaluating the overall feasibility of a pathway or individual steps in pathways in biological systems (Flamholz, E. Noor, A. Bar-Even, R. Milo (2012) eQuilibrator—the biochemical thermodynamics calculator Nucleic Acids Res 40:D770-5; Noor, A. Bar-Even, A. Flamholz, Y. Lubling, D. Davidi, R. Milo (2012) An integrated open framework for thermodynamics of reactions that combines accuracy and coverageBioinformatics 28:2037-2044; Noor, H. S. Haraldsdóttir, R. Milo, R. M. T. Fleming (2013) Consistent Estimation of Gibbs Energy Using Component Contributions PLoS Comput Biol 9(7): e1003098; Noor, A. Bar-Even, A. Flamholz, E. Reznik, W. Liebermeister, R. Milo (2014) Pathway Thermodynamics Highlights Kinetic Obstacles in Central Metabolism PLoS Comput Biol 10(2):e1003483). The calculations are as follows:
Glucose (aq)+3 NADH (aq)
6 CO (aq)+3 H2 (aq)+6 NADH (aq)
[0134]Physiological conditions:
Glucose (aq)+3 NADH (aq)
6 CO (aq)+3 H2 (aq)+6 NADH (aq)
[0135]In addition to ethylene glycol, glyoxylate, and/or glycolate, the microorganism of the invention may be cultured to produce one or more co-products products. For instance, the microorganism of the invention may produce or may be engineered to produce ethanol (WO 2007/117157), acetate (WO 2007/117157), butanol (WO 2008/115080 and WO 2012/053905), butyrate (WO 2008/115080), 2,3-butanediol (WO 2009/151342 and WO 2016/094334), lactate (WO 2011/112103), butene (WO 2012/024522), butadiene (WO 2012/024522), methyl ethyl ketone (2-butanone) (WO 2012/024522 and WO 2013/185123), ethylene (WO 2012/026833), acetone (WO 2012/115527), isopropanol (WO 2012/115527), lipids (WO 2013/036147), 3-hydroxypropionate (3-HP) (WO 2013/180581), isoprene (WO 2013/180584), fatty acids (WO 2013/191567), 2-butanol (WO 2013/185123), 1,2-propanediol (WO 2014/036152), 1-propanol (WO 2014/0369152), chorismate-derived products (WO 2016/191625), 3-hydroxybutyrate (WO 2017/066498), and 1,3-butanediol (WO 2017/0066498). In some embodiments, in addition to ethylene glycol, the microorganism of the invention also produces ethanol, 2,3-butanediol, and/or succinate. In certain embodiments, microbial biomass itself may be considered a product.
[0136]A “native product” is a product produced by a genetically unmodified microorganism. For example, ethanol, acetate, and 2,3-butanediol are native products of Clostridium autoethanogenum, Clostridium ljungdahlii, and Clostridium ragsdalei. A “non-native product” is a product that is produced by a genetically modified microorganism but is not produced by a genetically unmodified microorganism from which the genetically modified microorganism is derived. Ethylene glycol is not known to be produced by any naturally-occurring microorganism, such that it is a non-native product of all microorganisms.
[0137]“Selectivity” refers to the ratio of the production of a target product to the production of all fermentation products produced by a microorganism. The microorganism of the invention may be engineered to produce products at a certain selectivity or at a minimum selectivity. In one embodiment, a target product, such as ethylene glycol, accounts for at least about 5%, 10%, 15%, 20%, 30%, 50%, or 75% of all fermentation products produced by the microorganism of the invention. In one embodiment, ethylene glycol accounts for at least 10% of all fermentation products produced by the microorganism of the invention, such that the microorganism of the invention has a selectivity for ethylene glycol of at least 10%. In another embodiment, ethylene glycol accounts for at least 30% of all fermentation products produced by the microorganism of the invention, such that the microorganism of the invention has a selectivity for ethylene glycol of at least 30%.
[0138]Typically, the culture is performed in a bioreactor. The term “bioreactor” includes a culture/fermentation device consisting of one or more vessels, towers, or piping arrangements, such as a continuous stirred tank reactor (CSTR), immobilized cell reactor (ICR), trickle bed reactor (TBR), bubble column, gas lift fermenter, static mixer, or other vessel or other device suitable for gas-liquid contact. In some embodiments, the bioreactor may comprise a first growth reactor and a second culture/fermentation reactor. The substrate may be provided to one or both of these reactors. As used herein, the terms “culture” and “fermentation” are used interchangeably. These terms encompass both the growth phase and product biosynthesis phase of the culture/fermentation process.
[0139]The culture is generally maintained in an aqueous culture medium that contains nutrients, vitamins, and/or minerals sufficient to permit growth of the microorganism. Preferably the aqueous culture medium is an anaerobic microbial growth medium, such as a minimal anaerobic microbial growth medium. Suitable media are well known in the art.
[0140]The culture/fermentation should desirably be carried out under appropriate conditions for production of ethylene glycol. If necessary, the culture/fermentation is performed under anaerobic conditions. Reaction conditions to consider include pressure (or partial pressure), temperature, gas flow rate, liquid flow rate, media pH, media redox potential, agitation rate (if using a continuous stirred tank reactor), inoculum level, maximum gas substrate concentrations to ensure that gas in the liquid phase does not become limiting, and maximum product concentrations to avoid product inhibition. In particular, the rate of introduction of the substrate may be controlled to ensure that the concentration of gas in the liquid phase does not become limiting.
[0141]Operating a bioreactor at elevated pressures allows for an increased rate of gas mass transfer from the gas phase to the liquid phase. Accordingly, it is generally preferable to perform the culture/fermentation at pressures higher than atmospheric pressure. Also, since a given gas conversion rate is, in part, a function of the substrate retention time and retention time dictates the required volume of a bioreactor, the use of pressurized systems can greatly reduce the volume of the bioreactor required and, consequently, the capital cost of the culture/fermentation equipment. This, in turn, means that the retention time, defined as the liquid volume in the bioreactor divided by the input gas flow rate, can be reduced when bioreactors are maintained at elevated pressure rather than atmospheric pressure. The optimum reaction conditions will depend partly on the particular microorganism used. However, in general, it is preferable to operate the fermentation at a pressure higher than atmospheric pressure. Also, since a given gas conversion rate is in part a function of substrate retention time and achieving a desired retention time in turn dictates the required volume of a bioreactor, the use of pressurized systems can greatly reduce the volume of the bioreactor required, and consequently the capital cost of the fermentation equipment.
[0142]In certain embodiments, the fermentation is performed in the absence of light or in the presence of an amount of light insufficient to meet the energetic requirements of photosynthetic microorganisms. In certain embodiments, the microorganism of the invention is a non-photosynthetic microorganism.
[0143]The method of the invention may further comprise separating the ethylene glycol from the fermentation broth. Ethylene glycol may be separated or purified from a fermentation broth using any method or combination of methods known in the art, including, for example, distillation, simulated moving bed processes, membrane treatment, evaporation, pervaporation, gas stripping, phase separation, ion exchange, or extractive fermentation, including for example, liquid-liquid extraction. In one embodiment, ethylene glycol may be concentrated from the fermentation broth using reverse osmosis and/or pervaporation (U.S. Pat. No. 5,552,023). Water may be removed by distillation and the bottoms (containing a high proportion of ethylene glycol) may then be recovered using distillation or vacuum distillation to produce a high purity ethylene glycol stream. Alternatively, with or without concentration by reverse osmosis and/or pervaporation, ethylene glycol may be further purified by reactive distillation with an aldehyde (Atul, Chem Eng Sci, 59: 2881-2890, 2004) or azeotropic distillation using a hydrocarbon (U.S. Pat. No. 2,218,234). In another approach, ethylene glycol may be trapped on an activated carbon or polymer absorbent from aqueous solution (with or without reverse osmosis and/or pervaporation) and recovered using a low boiling organic solvent (Chinn, Recovery of Glycols, Sugars, and Related Multiple —OH Compounds from Dilute-Aqueous Solution by Regenerable Adsorption onto Activated Carbons, University of California Berkeley, 1999). Ethylene glycol can then be recovered from the organic solvent by distillation. In certain embodiments, ethylene glycol is recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, separating microbial cells from the broth (conveniently by filtration), and recovering ethylene glycol from the broth. Co-products, such as alcohols or acids may also be separated or purified from the broth. Alcohols may be recovered, for example, by distillation. Acids may be recovered, for example, by adsorption on activated charcoal. Separated microbial cells may be returned to the bioreactor in certain embodiments. The cell-free permeate remaining after target products have been removed is also preferably returned to the bioreactor, in whole or in part. Additional nutrients (such as B vitamins) may be added to the cell-free permeate to replenish the medium before it is returned to the bioreactor.
[0144]Recovery of diols from aqueous media has been demonstrated a number of ways. Simulated moving bed (SMB) technology has been used to recover 2,3-butanediol from an aqueous mixture of ethanol and associated oxygenates (U.S. Pat. No. 8,658.845). Reactive separation has also been demonstrated for effective diol recovery. In some embodiments, recovery of ethylene glycol is conducted by reaction of the diol-containing stream with aldehydes, fractionation and regeneration of the diol, final fractionation to recover a concentrated diol stream. See, e.g., U.S. Pat. No. 7,951,980.
[0145]The invention provides compositions comprising ethylene glycol produced by the microorganisms and according to the methods described herein. For example, the composition comprising ethylene glycol may be an antifreeze, preservative, dehydrating agent, or drilling fluid.
[0146]The invention also provides polymers comprising ethylene glycol produced by the microorganisms and according to the methods described herein. Such polymers may be, for example, homopolymers such as polyethylene glycol or copolymers such as polyethylene terephthalate. Methods for the synthesis of these polymers are well-known in the art. See, e.g., Herzberger et al., Chem Rev., 116(4): 2170-2243 (2016) and Xiao et al., Ind Eng Chem Res. 54(22): 5862-5869 (2015).
[0147]The invention further provides compositions comprising polymers comprising ethylene glycol produced by the microorganisms and according to the methods described herein. For example, the composition may be a fiber, resin, film, or plastic.
EXAMPLES
[0148]The following examples further illustrate the invention but, of course, should not be construed to limit its scope in any way.
Example 1: Construction of Heterologous Expression Vector Comprising B. subtilis Citrate Synthase, E. coli Isocitrate Lyase, and G. oxydans Glycolaldehyde Dehydrogenase for Production of Ethylene Glycol from CO and/or CO 2 and H 2 in C. autoethanogenum
[0149]Genes coding for citrate synthase from B. subtilis (citZ; SEQ ID NOs: 1-2), isocitrate lyase from E. coli (icl; SEQ ID NOs: 11-12), and glycolaldehyde dehydrogenase from G. oxydans (aldA1; SEQ ID NOs: 55-56) were codon-adapted and synthesized for expression in C. autoethanogenum. The adapted genes were cloned into an expression shuttle vector, pIPL12, using a standard BsaI golden gate cloning kit (New England Biolabs, Ipswich, Mass.). pIPL12 comprises an origin of replication for both E. coli and C. autoethanogenum, enabling it to replicate and be maintained in both species; pIPL12 also functions in most Clostridia. pIPL12 further comprises 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B) conferring erythromycin/clarithromycin resistance for positive selection, TraJ for conjugative transfer from E. coli, and a promoter for expression of heterologous genes. See
| TABLE 2 |
|---|
| Oligos used to construct pMEG042 expression |
| vector. |
| SEQ | ||
| ID | ||
| NO | Name | Sequence |
| 69 | pIPL12-bb-F | CACACCAGGTCTCAAACCATGGAGATCTCGAGG |
| CCTG | ||
| 70 | pIPL12-bb-R | CACACCAGGTCTCACATATGATAAGAAGACTCT |
| TGGC | ||
| 71 | citZ_Bs1-F | CACACCAGGTCTCACATATGACAGCAACAAGGG |
| GCC | ||
| 72 | citZ_Bs1-R | CACACCAGGTCTCAATTGTAACACCTCCTTAATT |
| AGTTATGCTCTTTCTTCTATAGGTACAAATTTTT | ||
| G | ||
| 73 | Ic1_Ec-F | CACACCAGGTCTCACAATGAAAACAAGAACTCA |
| ACAAATAG | ||
| 74 | Ic1_Ec-R | CACACCAGGTCTCAGTGTTCCTCCTATGTGTTCT |
| TAAAATTGAGATTCTTCAGTTGAACCTG | ||
| 75 | aldA1_Go-F | CACACCAGGTCTCAACACATATGACTGAAAAAA |
| ATAATTTATTCATAAATGGATC | ||
| 76 | aldA1_Go-R | CACACCAGGTCTCAGGTTATGCATTTAGATATAT |
| TGTTTTTGTCTGTACG | ||
[0150]The pMEG042 construct was transformed into C. autoethanogenum via conjugation. The expression vector was first introduced into the conjugative donor strain, E. coli HB101+R702 (CA434) (Williams et al. 1990) (the donor), using standard heat shock transformation. Donor cells were recovered in SOC media at 37° C. for 1 h before being plated onto LB media plates comprising 100 μg/mL spectinomycin and 500 μg/mL erythromycin and incubated at 37° C. overnight. The next day, 5 mL LB aliquots comprising 100 μg/mL spectinomycin and 500 μg/mL erythromycin were inoculated with several donor colonies and incubated at 37° C., shaking for approximately 4 h or until the culture was visibly dense but had not yet entered stationary phase. 1.5 mL of the donor culture was harvested by centrifugation at 4000 rpm and 20-25° C. for 2 min, and the supernatant was discarded. The donor cells were gently resuspended in 500 μL sterile PBS buffer and centrifuged at 4000 rpm for 2 min, and the PBS supernatant was discarded.
[0151]The pellet was introduced into an anaerobic chamber and gently resuspended in 200 μL during late exponential phase of a C. autoethanogenum culture (the recipient). C. autoethanogenum DSM10061 and DSM23693 (a derivate of DSM10061) were sourced from DSMZ (The German Collection of Microorganisms and Cell Cultures, Inhoffenstraße 7 B, 38124 Braunschweig, Germany). Strains were grown at 37° C. in PETC medium (See U.S. Pat. No. 9,738,875) at pH 5.6 using standard anaerobic techniques (Hungate 1969; Wolfe 1971).
[0152]The conjugation mixture (the mix of donor and recipient cells) was spotted onto PETC-MES+fructose agar plates and left to dry. When the spots were no longer visibly wet, the plates were introduced into a pressure jar, pressurized with syngas (50% CO, 10% N2, 30% CO2, 10% H2) to 25-30 psi, and incubated at 37° C. for ˜24 h. The conjugation mixture was then removed from the plates by gentle scraping using a 10 μL inoculation loop. The removed mixture was suspended in 200-300 μL PETC media. 100 μL aliquots of the conjugation mixture were plated onto PETC media agar plates supplemented 5 μg/mL clarithromycin to select for transformants bearing the plasmid.
[0153]Three distinct colonies of C. autoethanogenum bearing the pMEG042 plasmid were inoculated into 2 mL of PETC-MES media with 5 μg/mL clarithromycin and grown autotrophically at 37° C. with 50% CO, 10% N2, 30% CO2, 10% H2 and 100 rpm orbital shaking with for three days. Cultures were diluted to OD600 of 0.05 in 10 mL PETC-MES medium with 5 μg/mL clarithromycin in serum bottles and grown autotrophically at 37° C. with 50% CO, 10% N2, 30% CO2, 10% H2 and 100 rpm orbital shaking for up to 20 days, sampling daily to measure biomass and metabolites (
[0154]Ethylene glycol concentrations were measured with a Thermo Scientific ISQ LT GCMS equipped an Agilent VF-WAXms column (15 m×0.25 μm×0.25 μm) and RSH autosampler. Samples were prepared by diluting 200 μL of broth with 200 μL of methanol. The samples were vortexed then centrifuged for 3 min at 14,000 rpm; 200 μL of the supernatant was transferred to a glass vial with insert. Samples were transferred to an autosampler for analysis using a 1.0 μL injection, a split ratio of 5 to 1, and an inlet temperature of 240° C. Chromatography was performed with an oven program of 80° C. with a 0.5 min hold to a ramp of 10° C./min to 150° C. to a ramp of 25° C./min to 220° C. with a 3 min final hold. The column flow rate was 4.0 mL/min with a 0.5 min hold then dropping to 1.5 ml/min at a rate of 100 ml/min/min using helium as the carrier gas. The MS ion source was kept at 260° C. with the transfer line set at 240° C. Quantitation was performed using a linear external standard calibration using 33.0 m/z as the quantitation peak and 31.0+62.0 m/z as the confirming peaks.
[0155]Ethanol, acetate, 2,3-butanediol, glyoxylate, and glycolate concentrations were measured by HPLC on an Agilent 1260 Infinity LC with Refractive Index (RI) detection at 35° C. Samples were prepared by heating for 5 min at 80° C., followed by a 3 min centrifugation at 14,000 rpm; the supernatant was transferred to a glass vial for analysis. Separation was carried out with a 10 μL injection on to a Phenomenex Rezex™ ROA-Organic Acid H+ (8%) column (300 mm×7.8 mm×8 μm) at 0.7 mL/min and 35° C. under isocratic conditions, using 5 mM sulphuric acid mobile phase.
[0156]After approximately 3 days of autotrophic growth, the ethylene glycol precursor glycolate was observed, and after 10 days, production of ethylene glycol was observed (
Example 2: Construction of Heterologous Expression Vector Comprising S. thiotaurini Alanine-Glyoxylate Aminotransferase and P. fluorescens Aldehyde Dehydrogenase for Production of Ethylene Glycol from CO and/or CO 2 and H 2 in C. autoethanogenum
[0157]Genes coding for an alanine-glyoxylate aminotransferase from S. thiotaurini (pucG; SEQ ID NOs: 15-16) and aldehyde dehydrogenase from P. fluorescens Q8r1-96 (aldA1; SEQ ID NOs: 57-58) were codon-adapted and synthesized for expression in C. autoethanogenum. The codon-adapted genes were cloned into pIPL12 (
| TABLE 3 |
|---|
| Oligos used to construct pMEG058 expression |
| vector. |
| SEQ | ||
| ID | ||
| NO | Name | Sequence |
| 69 | pIPL12-bb-F | CACACCAGGTCTCAAACCATGGAGATCTCGAGG |
| CCTG | ||
| 70 | pIPL12-bb-R | CACACCAGGTCTCACATATGATAAGAAGACTCT |
| TGGC | ||
| 77 | PucG_Sthi1-F | CACACCAGGTCTCACATATGCAATTTAGGCCTTT |
| TAATCCACCA | ||
| 78 | PucG_Sthi1-R | CACACCAGGTCTCAGTGTTCCTCCTATGTGTTCT |
| TATGCTTGCGCAAGTGCCT | ||
| 79 | aldA1_Pfq8-F | CACACCAGGTCTCAACACATATGTCTTCAGTGCC |
| TGTATTCCAG | ||
| 80 | aldA1_Pfq8-R | CACACCAGGTCTCAGGTTAAGACTGGAGATATA |
| CTGCATGAG | ||
[0158]Two distinct colonies of C. autoethanogenum bearing the pMEG058 plasmid were inoculated into 2 mL of PETC-MES media with 5 μg/mL clarithromycin and grown autotrophically, as described in Example 1. See
Example 3: Construction of Heterologous Expression Vector Comprising S. thiotaurini Alanine-Glyoxylate Aminotransferase and G. oxydans Glycolaldehyde Dehydrogenase for Production of Ethylene Glycol from CO and/or CO 2 and H 2 in C. autoethanogenum
[0159]Genes coding for an alanine-glyoxylate aminotransferase from S. thiotaurini (pucG; SEQ ID NOs: 15-16) and glycolaldehyde dehydrogenase from G. oxydans (aldA1; SEQ ID NOs: 55-56) were codon-adapted and synthesized for expression in C. autoethanogenum. The codon-adapted genes were cloned into pIPL12 (
| TABLE 4 |
|---|
| Oligos used to construct pMEG059 expression |
| vector. |
| SEQ | ||
| ID | ||
| NO | Name | Sequence |
| 69 | pIPL12-bb-F | CACACCAGGTCTCAAACCATGGAGATCTCGAGG |
| CCTG | ||
| 70 | pIPL12-bb-R | CACACCAGGTCTCACATATGATAAGAAGACTCT |
| TGGC | ||
| 77 | PucG_Sthi1-F | CACACCAGGTCTCACATATGCAATTTAGGCCTTT |
| TAATCCACCA | ||
| 78 | PucG_Sthi1-R | CACACCAGGTCTCAGTGTTCCTCCTATGTGTTCT |
| TATGCTTGCGCAAGTGCCT | ||
| 75 | aldA1_Go-F | CACACCAGGTCTCAACACATATGACTGAAAAAA |
| ATAATTTATTCATAAATGGATC | ||
| 76 | aldA1_Go-R | CACACCAGGTCTCAGGTTATGCATTTAGATATAT |
| TGTTTTTGTCTGTACG | ||
[0160]Two distinct colonies of C. autoethanogenum bearing the pMEG059 plasmid were inoculated into 2 mL of PETC-MES medium with 5 μg/mL clarithromycin and grown autotrophically, as described in Example 1. See
Example 4: Construction of Heterologous Expression Vector Comprising Alanine-Glyoxylate Aminotransferase and Aldehyde Dehydrogenase for Production of Ethylene Glycol from CO and/or CO 2 and H 2 in C. autoethanogenum
[0161]Genes coding for class V aminotransferase from C. acidurici (SgA; SEQ ID NOs: 19, 20) and aldehyde dehydrogenase from P. fluorescens Q8r1-96 (aldA1; SEQ ID NOs: 57-58) were codon-adapted and synthesized for expression in C. autoethanogenum. The codon-adapted genes were cloned into pIPL12 (
| TABLE 5 |
|---|
| Oligos used to construct pMEG061 expression |
| vector. |
| SEQ | ||
| ID | ||
| NO | Name | Sequence |
| 69 | pIPL12-bb-F | CACACCAGGTCTCAAACCATGGAGATCTCGAG |
| GCCTG | ||
| 70 | pIPL12-bb-R | CACACCAGGTCTCACATATGATAAGAAGACTC |
| TTGGC | ||
| 81 | SgaA_Caci1-F | CACACCAGGTCTCACATATGAGAACTCCATTT |
| ATTATGAC | ||
| 82 | SgaA_Caci1-R | CACACCAGGTCTCAGTGTTCCTCCTATGTGTTC |
| CTAATCTACAAAGTGCTTG | ||
| 79 | aldA1_Pfq8-F | CACACCAGGTCTCAACACATATGTCTTCAGTG |
| CCTGTATTCCAG | ||
| 80 | aldA1_Pfq8-R | CACACCAGGTCTCAGGTTAAGACTGGAGATAT |
| ACTGCATGAG | ||
[0162]Three distinct colonies of C. autoethanogenum bearing the pMEG061 plasmid were inoculated into 2 mL of PETC-MES medium with 5 μg/mL clarithromycin and grown autotrophically, as described in Example 1. See
Example 5: Modeling of Maximum Yields of Different Routes to Ethylene Glycol
[0163]A genome-scale metabolic model of Clostridium autoethanogenum like the one described by Marcellin, Green Chem, 18: 3020-3028, 2016 was utilized to predict maximum yields of different routes to ethylene glycol. Heterologous metabolic reactions were added to the wild type Clostridium autoethanogenum model structure to represent the incorporation of the non-native compound production pathway. Although the model used for the experimental work described herein is based on Clostridium autoethanogenum, the results can reasonably be expected to apply to other Wood-Ljungdahl microorganisms as well, given similarities in metabolism.
[0164]Ethylene glycol production was simulated using constraint-based computational modeling techniques flux balance analysis (FBA) and linear minimization of metabolic adjustment (LMOMA) (Maia, Proceedings of the Genetic and Evolutionary Computation Conference Companion on—GECCO '17, New York, N.Y., ACM Press, 1661-1668, 2017) using cobrapy version 0.8.2 (Ebrahim., COBRApy: COnstraints-Based Reconstruction and Analysis for Python, BMC Syst Biol, 7: 74, 2013), with optlang version 1.2.3 (Jensen, Optlang: An Algebraic Modeling Language for Mathematical Optimization,” The Journal of Open Source Software, 2, doi:10.21105/joss.00139, 2017) as the solver interface and Gurobi Optimizer version 7.0.2 as the optimization solver.
[0165]Modeling revealed a predicted yield of 0.37 mol ethylene glycol/mol CO by the pathways described herein in Examples 1-4. This is more than double the predicted yield by the hypothetical pathways described by Islam et al. Metab Eng, 41: 173-181, 2017, which require gluconeogenesis; the highest predicted yields were found to be ˜0.44 g ethylene glycol/g CO, which equals ˜0.18 mol ethylene glycol/mol CO.
[0166]All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. The reference to any prior art in this specification is not, and should not be taken as, an acknowledgement that that prior art forms part of the common general knowledge in the field of endeavour in any country.
[0167]The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. The term “consisting essentially of” limits the scope of a composition, process, or method to the specified materials or steps, or to those that do not materially affect the basic and novel characteristics of the composition, process, or method. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the term “about” means ±20% of the indicated range, value, or structure, unless otherwise indicated.
[0168]Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, any concentration range, percentage range, ratio range, integer range, size range, or thickness range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
[0169]All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0170]Preferred embodiments of this invention are described herein. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
1. A genetically engineered C1-fixing microorganism capable of producing ethylene glycol or a precursor of ethylene glycol from a gaseous substrate, wherein the microorganism comprises a nucleic acid encoding a heterologous enzyme selected from a glycolaldehyde dehydrogenase having the EC number 1.2.1.21, a lactaldehyde dehydrogenase having the EC number 1.2.1.22, a succinate-semialdehyde dehydrogenase having the EC number 1.2.1.24, a 2,5-dioxovalerate dehydrogenase having the EC number 1.2.1.26, a betaine-aldehyde dehydrogenase having the EC number 1.2.1.8, or an aldehyde ferredoxin oxidoreductase having the EC number 1.2.7.5.
2. The microorganism of
3. The microorganism of
i) a nucleic acid encoding a heterologous enzyme capable of converting oxaloacetate to citrate;
ii) a nucleic acid encoding a heterologous enzyme capable of converting glycine to glyoxylate;
iii) a nucleic acid encoding a heterologous enzyme capable of converting iso-citrate to glyoxylate; or
iv) a nucleic acid encoding a heterologous enzyme capable of converting glycolate to glycolaldehyde.
4. The microorganism of
a. the heterologous enzyme capable of converting oxaloacetate to citrate is a citrate [Si]-synthase [2.3.3.1], an ATP citrate synthase [2.3.3.8]; or a citrate (Re)-synthase [2.3.3.3];
b. the heterologous enzyme capable of converting glycine to glyoxylate is an alanine-glyoxylate transaminase [2.6.1.44], a serine-glyoxylate transaminase [2.6.1.45], a serine-pyruvate transaminase [2.6.1.51], a glycine-oxaloacetate transaminase [2.6.1.35], a glycine transaminase [2.6.1.4], a glycine dehydrogenase [1.4.1.10], an alanine dehydrogenase [1.4.1.1], or a glycine dehydrogenase [1.4.2.1]; and/or
c. the heterologous enzyme capable of converting iso-citrate to glyoxylate is an isocitrate lyase [4.1.3.1].
5. The microorganism of
6. The microorganism of
7. The microorganism of
8. The microorganism of
i) the heterologous enzyme capable of converting oxaloacetate to citrate;
ii) the heterologous enzyme capable of converting glycine to glyoxylate; and/or
iii). the heterologous enzyme capable of converting glycolate to glycolaldehyde.
9. The microorganism of
i) the enzyme capable of converting pyruvate to oxaloacetate having the EC number 6.4.1.1;
ii) the enzyme capable of converting citrate to aconitate and aconitate to iso-citrate having the EC number 4.2.1.3;
iii) the enzyme capable of converting phosphoenolpyruvate to oxaloacetate having the EC number 4.1.1.49 or 4.1.1.32;
iv) the enzyme capable of converting serine to glycine having the EC number 2.1.2.1;
v) the enzyme capable of converting 5,10-methylenetetrahydrofolate to glycine having the EC number 1.4.4.2, 1.81.4, or 2.1.2.10;
vi) the enzyme capable of converting glyoxylate to glycolate having the EC number 2.3.3.9; and/or
vii) the enzyme capable of converting glycolaldehyde to ethylene glycol having the EC number 1.1.1.77, 1.1.1.1, 1.1.1.2, 1.1.1.72, 1.1.1.8, or 1.1.1.21.
10. The microorganism of
11. The microorganism of
12. The microorganism of
13. The microorganism of
14. The microorganism of
15. The microorganism of
16. A method of producing ethylene glycol or a precursor of ethylene glycol comprising culturing the microorganism of
17. The method of
18. The method of
19. The method of
20. The method of